Review



25 508 pbs  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    Thermo Fisher 25 508 pbs
    25 508 Pbs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/25+508+pbs/Tween+20/pm41638212-817-101-186
    Average 99 stars, based on 1 article reviews
    25 508 pbs - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    Membrane:

    Article Title: HMGB1 functions as a critical mediator of host defense at the gut mucosal barrier.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER E. coli FimH lectin domain; ToH1 mutant -His tagged Messer Laboratory FimH LD Mut Enterococcus faecalis Asa1 (Uniprot P17953) -His tagged Genscript Asa1 (Custom) Human HMGB1 peptide Abcam ab18650 Enterococcus faecalis Asa1 ToH1 peptide Genscript Asa1 ToH1 peptide (Custom) Bisbenzimide H 33258 (Hoechst) Sigma-Aldrich 14530 CAS: 23491-45-4 Bacto Peptone VWR 90000-264 Beef Extract VWR 90000-588 NaCl Fisher S671-500 Agar Fisher BP1423 500 Methanol Fisher A4124 Chloroform Fisher AC158210025 Glacial acetic acid Fisher BP2401 212 SYTO 9 Invitrogen S34854 Bovine Serum Albumin Sigma-Aldrich A2153-500G Paraformaldehyde Aqueous Solution Fisher 15710 Lysozyme Fisher PI89833 LB agar (Lennox) Sigma-Aldrich L2897-250G 3,3 ′ ,5,5 ′ -Tetramethylbenzidine (TMB) Sigma-Aldrich T8665-100ML Sulfuric acid Fisher AC424525001 Cell lysis buffer Cell Signaling Technology 9803S Complete protease inhibitor Roche 11836170001 Phenylmethylsulfonyl fluoride (PMSF) Gold Biotechnology P-470-10 14-2% NuPAGE Bis-Tris gels Fisher NP0321BOX 12% NuPAGE Bis-Tris gels Fisher NP0341BOX NuPAGE MOPS SDS Running Buffer Fisher NP0001 NuPAGE Transfer Buffer Fisher NP00061 Prolong glass mountant Thermo Fisher P36980 Clarity Western ECL Substrate Biorad 1705061 Formamide deionized MP Biomedical 11FORMD002 Kifunensine Cayman Chemical 10009437 D-(+)-mannose Sigma-Aldrich M6020 Advanced DMEM/F12 Life Technologies 12634 L-Glutamine Life Technologies 25030 Tween-20 Fisher BP337-500 DMEM Cleveland Clinic 11-500 Fetal Bovine Serum Gibco A5256701 HEPES buffer Life Technologies 15630 Penicillin and streptomycin Life Technologies 15140 N2 supplement Life Technologies 17502 B-27 Supplement Minus Vitamin A Life Technologies 12587 Murine Epidermal Growth Factor Peprotech 31509 Noggin Peprotech 250-38 Jagged 1 Anaspec AS-61298 Y-27632 Cayman Chemical Company 10005583 R-spondin Peprotech 120-38 TRIzol Life Technologies 15596026 SYBR Green Master Mix Bio-rad 172-51240 PowerUp SYBR Green Master Mix Applied Biosystems A25777 RemelTM BHI Broth Thermo Scientific R452472 (Continued on next page) Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Propidium iodide Alfa Aesar J66764MC CellBrite®Fix Membrane Stains (488, 555) Biotium 30090, 30088 NuPAGE LDS Invitrogen NP0007 NUPAGE 3-8% Tris-acetate gel Invitrogen EA0375Box Intercept (PBS) blocking buffer LICORbio 927-7 NuPAGE Tris-acetate SDS running buffer Invitrogen LA0041 Sodium Dodecyl Sulfate (SDS) Fisher Scientific BP166-100 β-mercaptoethanol MP Biomedicals 0219483425 SuperiorTM Blocking Buffer Thomas Scientific C752H38 EZ-link NHS-biotin Thermo Scientific 20217 High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814 Sulfo-SBED Thermo Scientific 33033 PurMa Agarose Low Melting Point PurMa Biologics PIM0121117-50 Guinea Pig Red Blood Cells Innovative Research IGPRBC10ML Anti-DYKDDDDK affinity resin Pierce A36802 Dulbecco’s PBS (DPBS) Genesse Scientific 25-508 PBS (Phosphate buffered saline; 137 mM NaCl, 2.7 mM KCl, 10 mM10mM Na 2 HPO 4 , 1.8 mM8mM KH 2 PO 4 , 137mM NaCl, 2.7mM KCl, pH 7.4) N/A N/A TBS (Tris-buffered saline; 20 mM20mM Tris, 150 mM-Cl, 150mM NaCl, pH 7.5 ) N/A N/A PBS-T (PBS, 0.1 % Tween 20, pH 7.4) N/A N/A TBS-T (TBS, 0.1% Tween 20) N/A N/A Laemmli sample buffer Bio-Rad 161-0737 Critical commercial assays HMGB1 Detection Kit Chondrex, Inc 6010 DNeasy Powerlyzer Microbial kit Qiagen 12255-50 Pierce BCA protein assay Thermo Scientific PI23227 Molecular ProbesTM Alexa FluorTM 647 Microscale Protein Labeling Kit Invitrogen A30009 CellEvent Caspase-3/7 Red detection reagent Invitrogen C10430 Deposited data Bacterial 16S rRNA gene sequencing data DOI: 10.5281/zenodo.14968005 Experimental models: Cell lines C2BBe1 [clone of Caco-2] CRL-2102TM ATCC C2BBe1 WT and ΔHMGB1 Cyagen Custom Experimental models: Organisms/strains Hmgb1 fl/fl (WT) mice Eugene Chang Hmgb1 tm1.1Ebc Hmgb1 fl/fl,Vil-CRE (ΔIEC) Eugene Chang Hmgb1 tm1.1Ebc crossed to Tg(Vil1-cre)20Syr SPF C57BL/6J Jackson Labs 000664; RRID: IMSR_JAX:000664 Germ-free C57BL/6 University of Chicago and Cleveland Clinic Gnotobiotics Core Facilities RRID: IMSR_TAC:B6 Oligonucleotides 5ATTO647NN/GCT GCC TCC CGT AGG AGT IDT ATTO647NN EUB338 probe GGCATTCGGGCTCCTTTCTT Invitrogen Mouse Muc1 F TGGAGTGGTAGTCGATGCTAAG Invitrogen Mouse Muc1 R AGGGCTCGGAACTCCAGAAA Invitrogen Mouse Muc2 F (Continued on next page) e3 Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 ..

    Blocking Assay:

    Article Title: HMGB1 functions as a critical mediator of host defense at the gut mucosal barrier.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER E. coli FimH lectin domain; ToH1 mutant -His tagged Messer Laboratory FimH LD Mut Enterococcus faecalis Asa1 (Uniprot P17953) -His tagged Genscript Asa1 (Custom) Human HMGB1 peptide Abcam ab18650 Enterococcus faecalis Asa1 ToH1 peptide Genscript Asa1 ToH1 peptide (Custom) Bisbenzimide H 33258 (Hoechst) Sigma-Aldrich 14530 CAS: 23491-45-4 Bacto Peptone VWR 90000-264 Beef Extract VWR 90000-588 NaCl Fisher S671-500 Agar Fisher BP1423 500 Methanol Fisher A4124 Chloroform Fisher AC158210025 Glacial acetic acid Fisher BP2401 212 SYTO 9 Invitrogen S34854 Bovine Serum Albumin Sigma-Aldrich A2153-500G Paraformaldehyde Aqueous Solution Fisher 15710 Lysozyme Fisher PI89833 LB agar (Lennox) Sigma-Aldrich L2897-250G 3,3 ′ ,5,5 ′ -Tetramethylbenzidine (TMB) Sigma-Aldrich T8665-100ML Sulfuric acid Fisher AC424525001 Cell lysis buffer Cell Signaling Technology 9803S Complete protease inhibitor Roche 11836170001 Phenylmethylsulfonyl fluoride (PMSF) Gold Biotechnology P-470-10 14-2% NuPAGE Bis-Tris gels Fisher NP0321BOX 12% NuPAGE Bis-Tris gels Fisher NP0341BOX NuPAGE MOPS SDS Running Buffer Fisher NP0001 NuPAGE Transfer Buffer Fisher NP00061 Prolong glass mountant Thermo Fisher P36980 Clarity Western ECL Substrate Biorad 1705061 Formamide deionized MP Biomedical 11FORMD002 Kifunensine Cayman Chemical 10009437 D-(+)-mannose Sigma-Aldrich M6020 Advanced DMEM/F12 Life Technologies 12634 L-Glutamine Life Technologies 25030 Tween-20 Fisher BP337-500 DMEM Cleveland Clinic 11-500 Fetal Bovine Serum Gibco A5256701 HEPES buffer Life Technologies 15630 Penicillin and streptomycin Life Technologies 15140 N2 supplement Life Technologies 17502 B-27 Supplement Minus Vitamin A Life Technologies 12587 Murine Epidermal Growth Factor Peprotech 31509 Noggin Peprotech 250-38 Jagged 1 Anaspec AS-61298 Y-27632 Cayman Chemical Company 10005583 R-spondin Peprotech 120-38 TRIzol Life Technologies 15596026 SYBR Green Master Mix Bio-rad 172-51240 PowerUp SYBR Green Master Mix Applied Biosystems A25777 RemelTM BHI Broth Thermo Scientific R452472 (Continued on next page) Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Propidium iodide Alfa Aesar J66764MC CellBrite®Fix Membrane Stains (488, 555) Biotium 30090, 30088 NuPAGE LDS Invitrogen NP0007 NUPAGE 3-8% Tris-acetate gel Invitrogen EA0375Box Intercept (PBS) blocking buffer LICORbio 927-7 NuPAGE Tris-acetate SDS running buffer Invitrogen LA0041 Sodium Dodecyl Sulfate (SDS) Fisher Scientific BP166-100 β-mercaptoethanol MP Biomedicals 0219483425 SuperiorTM Blocking Buffer Thomas Scientific C752H38 EZ-link NHS-biotin Thermo Scientific 20217 High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814 Sulfo-SBED Thermo Scientific 33033 PurMa Agarose Low Melting Point PurMa Biologics PIM0121117-50 Guinea Pig Red Blood Cells Innovative Research IGPRBC10ML Anti-DYKDDDDK affinity resin Pierce A36802 Dulbecco’s PBS (DPBS) Genesse Scientific 25-508 PBS (Phosphate buffered saline; 137 mM NaCl, 2.7 mM KCl, 10 mM10mM Na 2 HPO 4 , 1.8 mM8mM KH 2 PO 4 , 137mM NaCl, 2.7mM KCl, pH 7.4) N/A N/A TBS (Tris-buffered saline; 20 mM20mM Tris, 150 mM-Cl, 150mM NaCl, pH 7.5 ) N/A N/A PBS-T (PBS, 0.1 % Tween 20, pH 7.4) N/A N/A TBS-T (TBS, 0.1% Tween 20) N/A N/A Laemmli sample buffer Bio-Rad 161-0737 Critical commercial assays HMGB1 Detection Kit Chondrex, Inc 6010 DNeasy Powerlyzer Microbial kit Qiagen 12255-50 Pierce BCA protein assay Thermo Scientific PI23227 Molecular ProbesTM Alexa FluorTM 647 Microscale Protein Labeling Kit Invitrogen A30009 CellEvent Caspase-3/7 Red detection reagent Invitrogen C10430 Deposited data Bacterial 16S rRNA gene sequencing data DOI: 10.5281/zenodo.14968005 Experimental models: Cell lines C2BBe1 [clone of Caco-2] CRL-2102TM ATCC C2BBe1 WT and ΔHMGB1 Cyagen Custom Experimental models: Organisms/strains Hmgb1 fl/fl (WT) mice Eugene Chang Hmgb1 tm1.1Ebc Hmgb1 fl/fl,Vil-CRE (ΔIEC) Eugene Chang Hmgb1 tm1.1Ebc crossed to Tg(Vil1-cre)20Syr SPF C57BL/6J Jackson Labs 000664; RRID: IMSR_JAX:000664 Germ-free C57BL/6 University of Chicago and Cleveland Clinic Gnotobiotics Core Facilities RRID: IMSR_TAC:B6 Oligonucleotides 5ATTO647NN/GCT GCC TCC CGT AGG AGT IDT ATTO647NN EUB338 probe GGCATTCGGGCTCCTTTCTT Invitrogen Mouse Muc1 F TGGAGTGGTAGTCGATGCTAAG Invitrogen Mouse Muc1 R AGGGCTCGGAACTCCAGAAA Invitrogen Mouse Muc2 F (Continued on next page) e3 Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 ..

    Reverse Transcription:

    Article Title: HMGB1 functions as a critical mediator of host defense at the gut mucosal barrier.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER E. coli FimH lectin domain; ToH1 mutant -His tagged Messer Laboratory FimH LD Mut Enterococcus faecalis Asa1 (Uniprot P17953) -His tagged Genscript Asa1 (Custom) Human HMGB1 peptide Abcam ab18650 Enterococcus faecalis Asa1 ToH1 peptide Genscript Asa1 ToH1 peptide (Custom) Bisbenzimide H 33258 (Hoechst) Sigma-Aldrich 14530 CAS: 23491-45-4 Bacto Peptone VWR 90000-264 Beef Extract VWR 90000-588 NaCl Fisher S671-500 Agar Fisher BP1423 500 Methanol Fisher A4124 Chloroform Fisher AC158210025 Glacial acetic acid Fisher BP2401 212 SYTO 9 Invitrogen S34854 Bovine Serum Albumin Sigma-Aldrich A2153-500G Paraformaldehyde Aqueous Solution Fisher 15710 Lysozyme Fisher PI89833 LB agar (Lennox) Sigma-Aldrich L2897-250G 3,3 ′ ,5,5 ′ -Tetramethylbenzidine (TMB) Sigma-Aldrich T8665-100ML Sulfuric acid Fisher AC424525001 Cell lysis buffer Cell Signaling Technology 9803S Complete protease inhibitor Roche 11836170001 Phenylmethylsulfonyl fluoride (PMSF) Gold Biotechnology P-470-10 14-2% NuPAGE Bis-Tris gels Fisher NP0321BOX 12% NuPAGE Bis-Tris gels Fisher NP0341BOX NuPAGE MOPS SDS Running Buffer Fisher NP0001 NuPAGE Transfer Buffer Fisher NP00061 Prolong glass mountant Thermo Fisher P36980 Clarity Western ECL Substrate Biorad 1705061 Formamide deionized MP Biomedical 11FORMD002 Kifunensine Cayman Chemical 10009437 D-(+)-mannose Sigma-Aldrich M6020 Advanced DMEM/F12 Life Technologies 12634 L-Glutamine Life Technologies 25030 Tween-20 Fisher BP337-500 DMEM Cleveland Clinic 11-500 Fetal Bovine Serum Gibco A5256701 HEPES buffer Life Technologies 15630 Penicillin and streptomycin Life Technologies 15140 N2 supplement Life Technologies 17502 B-27 Supplement Minus Vitamin A Life Technologies 12587 Murine Epidermal Growth Factor Peprotech 31509 Noggin Peprotech 250-38 Jagged 1 Anaspec AS-61298 Y-27632 Cayman Chemical Company 10005583 R-spondin Peprotech 120-38 TRIzol Life Technologies 15596026 SYBR Green Master Mix Bio-rad 172-51240 PowerUp SYBR Green Master Mix Applied Biosystems A25777 RemelTM BHI Broth Thermo Scientific R452472 (Continued on next page) Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Propidium iodide Alfa Aesar J66764MC CellBrite®Fix Membrane Stains (488, 555) Biotium 30090, 30088 NuPAGE LDS Invitrogen NP0007 NUPAGE 3-8% Tris-acetate gel Invitrogen EA0375Box Intercept (PBS) blocking buffer LICORbio 927-7 NuPAGE Tris-acetate SDS running buffer Invitrogen LA0041 Sodium Dodecyl Sulfate (SDS) Fisher Scientific BP166-100 β-mercaptoethanol MP Biomedicals 0219483425 SuperiorTM Blocking Buffer Thomas Scientific C752H38 EZ-link NHS-biotin Thermo Scientific 20217 High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814 Sulfo-SBED Thermo Scientific 33033 PurMa Agarose Low Melting Point PurMa Biologics PIM0121117-50 Guinea Pig Red Blood Cells Innovative Research IGPRBC10ML Anti-DYKDDDDK affinity resin Pierce A36802 Dulbecco’s PBS (DPBS) Genesse Scientific 25-508 PBS (Phosphate buffered saline; 137 mM NaCl, 2.7 mM KCl, 10 mM10mM Na 2 HPO 4 , 1.8 mM8mM KH 2 PO 4 , 137mM NaCl, 2.7mM KCl, pH 7.4) N/A N/A TBS (Tris-buffered saline; 20 mM20mM Tris, 150 mM-Cl, 150mM NaCl, pH 7.5 ) N/A N/A PBS-T (PBS, 0.1 % Tween 20, pH 7.4) N/A N/A TBS-T (TBS, 0.1% Tween 20) N/A N/A Laemmli sample buffer Bio-Rad 161-0737 Critical commercial assays HMGB1 Detection Kit Chondrex, Inc 6010 DNeasy Powerlyzer Microbial kit Qiagen 12255-50 Pierce BCA protein assay Thermo Scientific PI23227 Molecular ProbesTM Alexa FluorTM 647 Microscale Protein Labeling Kit Invitrogen A30009 CellEvent Caspase-3/7 Red detection reagent Invitrogen C10430 Deposited data Bacterial 16S rRNA gene sequencing data DOI: 10.5281/zenodo.14968005 Experimental models: Cell lines C2BBe1 [clone of Caco-2] CRL-2102TM ATCC C2BBe1 WT and ΔHMGB1 Cyagen Custom Experimental models: Organisms/strains Hmgb1 fl/fl (WT) mice Eugene Chang Hmgb1 tm1.1Ebc Hmgb1 fl/fl,Vil-CRE (ΔIEC) Eugene Chang Hmgb1 tm1.1Ebc crossed to Tg(Vil1-cre)20Syr SPF C57BL/6J Jackson Labs 000664; RRID: IMSR_JAX:000664 Germ-free C57BL/6 University of Chicago and Cleveland Clinic Gnotobiotics Core Facilities RRID: IMSR_TAC:B6 Oligonucleotides 5ATTO647NN/GCT GCC TCC CGT AGG AGT IDT ATTO647NN EUB338 probe GGCATTCGGGCTCCTTTCTT Invitrogen Mouse Muc1 F TGGAGTGGTAGTCGATGCTAAG Invitrogen Mouse Muc1 R AGGGCTCGGAACTCCAGAAA Invitrogen Mouse Muc2 F (Continued on next page) e3 Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 ..

    Saline:

    Article Title: HMGB1 functions as a critical mediator of host defense at the gut mucosal barrier.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER E. coli FimH lectin domain; ToH1 mutant -His tagged Messer Laboratory FimH LD Mut Enterococcus faecalis Asa1 (Uniprot P17953) -His tagged Genscript Asa1 (Custom) Human HMGB1 peptide Abcam ab18650 Enterococcus faecalis Asa1 ToH1 peptide Genscript Asa1 ToH1 peptide (Custom) Bisbenzimide H 33258 (Hoechst) Sigma-Aldrich 14530 CAS: 23491-45-4 Bacto Peptone VWR 90000-264 Beef Extract VWR 90000-588 NaCl Fisher S671-500 Agar Fisher BP1423 500 Methanol Fisher A4124 Chloroform Fisher AC158210025 Glacial acetic acid Fisher BP2401 212 SYTO 9 Invitrogen S34854 Bovine Serum Albumin Sigma-Aldrich A2153-500G Paraformaldehyde Aqueous Solution Fisher 15710 Lysozyme Fisher PI89833 LB agar (Lennox) Sigma-Aldrich L2897-250G 3,3 ′ ,5,5 ′ -Tetramethylbenzidine (TMB) Sigma-Aldrich T8665-100ML Sulfuric acid Fisher AC424525001 Cell lysis buffer Cell Signaling Technology 9803S Complete protease inhibitor Roche 11836170001 Phenylmethylsulfonyl fluoride (PMSF) Gold Biotechnology P-470-10 14-2% NuPAGE Bis-Tris gels Fisher NP0321BOX 12% NuPAGE Bis-Tris gels Fisher NP0341BOX NuPAGE MOPS SDS Running Buffer Fisher NP0001 NuPAGE Transfer Buffer Fisher NP00061 Prolong glass mountant Thermo Fisher P36980 Clarity Western ECL Substrate Biorad 1705061 Formamide deionized MP Biomedical 11FORMD002 Kifunensine Cayman Chemical 10009437 D-(+)-mannose Sigma-Aldrich M6020 Advanced DMEM/F12 Life Technologies 12634 L-Glutamine Life Technologies 25030 Tween-20 Fisher BP337-500 DMEM Cleveland Clinic 11-500 Fetal Bovine Serum Gibco A5256701 HEPES buffer Life Technologies 15630 Penicillin and streptomycin Life Technologies 15140 N2 supplement Life Technologies 17502 B-27 Supplement Minus Vitamin A Life Technologies 12587 Murine Epidermal Growth Factor Peprotech 31509 Noggin Peprotech 250-38 Jagged 1 Anaspec AS-61298 Y-27632 Cayman Chemical Company 10005583 R-spondin Peprotech 120-38 TRIzol Life Technologies 15596026 SYBR Green Master Mix Bio-rad 172-51240 PowerUp SYBR Green Master Mix Applied Biosystems A25777 RemelTM BHI Broth Thermo Scientific R452472 (Continued on next page) Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Propidium iodide Alfa Aesar J66764MC CellBrite®Fix Membrane Stains (488, 555) Biotium 30090, 30088 NuPAGE LDS Invitrogen NP0007 NUPAGE 3-8% Tris-acetate gel Invitrogen EA0375Box Intercept (PBS) blocking buffer LICORbio 927-7 NuPAGE Tris-acetate SDS running buffer Invitrogen LA0041 Sodium Dodecyl Sulfate (SDS) Fisher Scientific BP166-100 β-mercaptoethanol MP Biomedicals 0219483425 SuperiorTM Blocking Buffer Thomas Scientific C752H38 EZ-link NHS-biotin Thermo Scientific 20217 High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814 Sulfo-SBED Thermo Scientific 33033 PurMa Agarose Low Melting Point PurMa Biologics PIM0121117-50 Guinea Pig Red Blood Cells Innovative Research IGPRBC10ML Anti-DYKDDDDK affinity resin Pierce A36802 Dulbecco’s PBS (DPBS) Genesse Scientific 25-508 PBS (Phosphate buffered saline; 137 mM NaCl, 2.7 mM KCl, 10 mM10mM Na 2 HPO 4 , 1.8 mM8mM KH 2 PO 4 , 137mM NaCl, 2.7mM KCl, pH 7.4) N/A N/A TBS (Tris-buffered saline; 20 mM20mM Tris, 150 mM-Cl, 150mM NaCl, pH 7.5 ) N/A N/A PBS-T (PBS, 0.1 % Tween 20, pH 7.4) N/A N/A TBS-T (TBS, 0.1% Tween 20) N/A N/A Laemmli sample buffer Bio-Rad 161-0737 Critical commercial assays HMGB1 Detection Kit Chondrex, Inc 6010 DNeasy Powerlyzer Microbial kit Qiagen 12255-50 Pierce BCA protein assay Thermo Scientific PI23227 Molecular ProbesTM Alexa FluorTM 647 Microscale Protein Labeling Kit Invitrogen A30009 CellEvent Caspase-3/7 Red detection reagent Invitrogen C10430 Deposited data Bacterial 16S rRNA gene sequencing data DOI: 10.5281/zenodo.14968005 Experimental models: Cell lines C2BBe1 [clone of Caco-2] CRL-2102TM ATCC C2BBe1 WT and ΔHMGB1 Cyagen Custom Experimental models: Organisms/strains Hmgb1 fl/fl (WT) mice Eugene Chang Hmgb1 tm1.1Ebc Hmgb1 fl/fl,Vil-CRE (ΔIEC) Eugene Chang Hmgb1 tm1.1Ebc crossed to Tg(Vil1-cre)20Syr SPF C57BL/6J Jackson Labs 000664; RRID: IMSR_JAX:000664 Germ-free C57BL/6 University of Chicago and Cleveland Clinic Gnotobiotics Core Facilities RRID: IMSR_TAC:B6 Oligonucleotides 5ATTO647NN/GCT GCC TCC CGT AGG AGT IDT ATTO647NN EUB338 probe GGCATTCGGGCTCCTTTCTT Invitrogen Mouse Muc1 F TGGAGTGGTAGTCGATGCTAAG Invitrogen Mouse Muc1 R AGGGCTCGGAACTCCAGAAA Invitrogen Mouse Muc2 F (Continued on next page) e3 Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 ..

    Bicinchoninic Acid Protein Assay:

    Article Title: HMGB1 functions as a critical mediator of host defense at the gut mucosal barrier.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER E. coli FimH lectin domain; ToH1 mutant -His tagged Messer Laboratory FimH LD Mut Enterococcus faecalis Asa1 (Uniprot P17953) -His tagged Genscript Asa1 (Custom) Human HMGB1 peptide Abcam ab18650 Enterococcus faecalis Asa1 ToH1 peptide Genscript Asa1 ToH1 peptide (Custom) Bisbenzimide H 33258 (Hoechst) Sigma-Aldrich 14530 CAS: 23491-45-4 Bacto Peptone VWR 90000-264 Beef Extract VWR 90000-588 NaCl Fisher S671-500 Agar Fisher BP1423 500 Methanol Fisher A4124 Chloroform Fisher AC158210025 Glacial acetic acid Fisher BP2401 212 SYTO 9 Invitrogen S34854 Bovine Serum Albumin Sigma-Aldrich A2153-500G Paraformaldehyde Aqueous Solution Fisher 15710 Lysozyme Fisher PI89833 LB agar (Lennox) Sigma-Aldrich L2897-250G 3,3 ′ ,5,5 ′ -Tetramethylbenzidine (TMB) Sigma-Aldrich T8665-100ML Sulfuric acid Fisher AC424525001 Cell lysis buffer Cell Signaling Technology 9803S Complete protease inhibitor Roche 11836170001 Phenylmethylsulfonyl fluoride (PMSF) Gold Biotechnology P-470-10 14-2% NuPAGE Bis-Tris gels Fisher NP0321BOX 12% NuPAGE Bis-Tris gels Fisher NP0341BOX NuPAGE MOPS SDS Running Buffer Fisher NP0001 NuPAGE Transfer Buffer Fisher NP00061 Prolong glass mountant Thermo Fisher P36980 Clarity Western ECL Substrate Biorad 1705061 Formamide deionized MP Biomedical 11FORMD002 Kifunensine Cayman Chemical 10009437 D-(+)-mannose Sigma-Aldrich M6020 Advanced DMEM/F12 Life Technologies 12634 L-Glutamine Life Technologies 25030 Tween-20 Fisher BP337-500 DMEM Cleveland Clinic 11-500 Fetal Bovine Serum Gibco A5256701 HEPES buffer Life Technologies 15630 Penicillin and streptomycin Life Technologies 15140 N2 supplement Life Technologies 17502 B-27 Supplement Minus Vitamin A Life Technologies 12587 Murine Epidermal Growth Factor Peprotech 31509 Noggin Peprotech 250-38 Jagged 1 Anaspec AS-61298 Y-27632 Cayman Chemical Company 10005583 R-spondin Peprotech 120-38 TRIzol Life Technologies 15596026 SYBR Green Master Mix Bio-rad 172-51240 PowerUp SYBR Green Master Mix Applied Biosystems A25777 RemelTM BHI Broth Thermo Scientific R452472 (Continued on next page) Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Propidium iodide Alfa Aesar J66764MC CellBrite®Fix Membrane Stains (488, 555) Biotium 30090, 30088 NuPAGE LDS Invitrogen NP0007 NUPAGE 3-8% Tris-acetate gel Invitrogen EA0375Box Intercept (PBS) blocking buffer LICORbio 927-7 NuPAGE Tris-acetate SDS running buffer Invitrogen LA0041 Sodium Dodecyl Sulfate (SDS) Fisher Scientific BP166-100 β-mercaptoethanol MP Biomedicals 0219483425 SuperiorTM Blocking Buffer Thomas Scientific C752H38 EZ-link NHS-biotin Thermo Scientific 20217 High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814 Sulfo-SBED Thermo Scientific 33033 PurMa Agarose Low Melting Point PurMa Biologics PIM0121117-50 Guinea Pig Red Blood Cells Innovative Research IGPRBC10ML Anti-DYKDDDDK affinity resin Pierce A36802 Dulbecco’s PBS (DPBS) Genesse Scientific 25-508 PBS (Phosphate buffered saline; 137 mM NaCl, 2.7 mM KCl, 10 mM10mM Na 2 HPO 4 , 1.8 mM8mM KH 2 PO 4 , 137mM NaCl, 2.7mM KCl, pH 7.4) N/A N/A TBS (Tris-buffered saline; 20 mM20mM Tris, 150 mM-Cl, 150mM NaCl, pH 7.5 ) N/A N/A PBS-T (PBS, 0.1 % Tween 20, pH 7.4) N/A N/A TBS-T (TBS, 0.1% Tween 20) N/A N/A Laemmli sample buffer Bio-Rad 161-0737 Critical commercial assays HMGB1 Detection Kit Chondrex, Inc 6010 DNeasy Powerlyzer Microbial kit Qiagen 12255-50 Pierce BCA protein assay Thermo Scientific PI23227 Molecular ProbesTM Alexa FluorTM 647 Microscale Protein Labeling Kit Invitrogen A30009 CellEvent Caspase-3/7 Red detection reagent Invitrogen C10430 Deposited data Bacterial 16S rRNA gene sequencing data DOI: 10.5281/zenodo.14968005 Experimental models: Cell lines C2BBe1 [clone of Caco-2] CRL-2102TM ATCC C2BBe1 WT and ΔHMGB1 Cyagen Custom Experimental models: Organisms/strains Hmgb1 fl/fl (WT) mice Eugene Chang Hmgb1 tm1.1Ebc Hmgb1 fl/fl,Vil-CRE (ΔIEC) Eugene Chang Hmgb1 tm1.1Ebc crossed to Tg(Vil1-cre)20Syr SPF C57BL/6J Jackson Labs 000664; RRID: IMSR_JAX:000664 Germ-free C57BL/6 University of Chicago and Cleveland Clinic Gnotobiotics Core Facilities RRID: IMSR_TAC:B6 Oligonucleotides 5ATTO647NN/GCT GCC TCC CGT AGG AGT IDT ATTO647NN EUB338 probe GGCATTCGGGCTCCTTTCTT Invitrogen Mouse Muc1 F TGGAGTGGTAGTCGATGCTAAG Invitrogen Mouse Muc1 R AGGGCTCGGAACTCCAGAAA Invitrogen Mouse Muc2 F (Continued on next page) e3 Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 ..

    Labeling:

    Article Title: HMGB1 functions as a critical mediator of host defense at the gut mucosal barrier.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER E. coli FimH lectin domain; ToH1 mutant -His tagged Messer Laboratory FimH LD Mut Enterococcus faecalis Asa1 (Uniprot P17953) -His tagged Genscript Asa1 (Custom) Human HMGB1 peptide Abcam ab18650 Enterococcus faecalis Asa1 ToH1 peptide Genscript Asa1 ToH1 peptide (Custom) Bisbenzimide H 33258 (Hoechst) Sigma-Aldrich 14530 CAS: 23491-45-4 Bacto Peptone VWR 90000-264 Beef Extract VWR 90000-588 NaCl Fisher S671-500 Agar Fisher BP1423 500 Methanol Fisher A4124 Chloroform Fisher AC158210025 Glacial acetic acid Fisher BP2401 212 SYTO 9 Invitrogen S34854 Bovine Serum Albumin Sigma-Aldrich A2153-500G Paraformaldehyde Aqueous Solution Fisher 15710 Lysozyme Fisher PI89833 LB agar (Lennox) Sigma-Aldrich L2897-250G 3,3 ′ ,5,5 ′ -Tetramethylbenzidine (TMB) Sigma-Aldrich T8665-100ML Sulfuric acid Fisher AC424525001 Cell lysis buffer Cell Signaling Technology 9803S Complete protease inhibitor Roche 11836170001 Phenylmethylsulfonyl fluoride (PMSF) Gold Biotechnology P-470-10 14-2% NuPAGE Bis-Tris gels Fisher NP0321BOX 12% NuPAGE Bis-Tris gels Fisher NP0341BOX NuPAGE MOPS SDS Running Buffer Fisher NP0001 NuPAGE Transfer Buffer Fisher NP00061 Prolong glass mountant Thermo Fisher P36980 Clarity Western ECL Substrate Biorad 1705061 Formamide deionized MP Biomedical 11FORMD002 Kifunensine Cayman Chemical 10009437 D-(+)-mannose Sigma-Aldrich M6020 Advanced DMEM/F12 Life Technologies 12634 L-Glutamine Life Technologies 25030 Tween-20 Fisher BP337-500 DMEM Cleveland Clinic 11-500 Fetal Bovine Serum Gibco A5256701 HEPES buffer Life Technologies 15630 Penicillin and streptomycin Life Technologies 15140 N2 supplement Life Technologies 17502 B-27 Supplement Minus Vitamin A Life Technologies 12587 Murine Epidermal Growth Factor Peprotech 31509 Noggin Peprotech 250-38 Jagged 1 Anaspec AS-61298 Y-27632 Cayman Chemical Company 10005583 R-spondin Peprotech 120-38 TRIzol Life Technologies 15596026 SYBR Green Master Mix Bio-rad 172-51240 PowerUp SYBR Green Master Mix Applied Biosystems A25777 RemelTM BHI Broth Thermo Scientific R452472 (Continued on next page) Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Propidium iodide Alfa Aesar J66764MC CellBrite®Fix Membrane Stains (488, 555) Biotium 30090, 30088 NuPAGE LDS Invitrogen NP0007 NUPAGE 3-8% Tris-acetate gel Invitrogen EA0375Box Intercept (PBS) blocking buffer LICORbio 927-7 NuPAGE Tris-acetate SDS running buffer Invitrogen LA0041 Sodium Dodecyl Sulfate (SDS) Fisher Scientific BP166-100 β-mercaptoethanol MP Biomedicals 0219483425 SuperiorTM Blocking Buffer Thomas Scientific C752H38 EZ-link NHS-biotin Thermo Scientific 20217 High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814 Sulfo-SBED Thermo Scientific 33033 PurMa Agarose Low Melting Point PurMa Biologics PIM0121117-50 Guinea Pig Red Blood Cells Innovative Research IGPRBC10ML Anti-DYKDDDDK affinity resin Pierce A36802 Dulbecco’s PBS (DPBS) Genesse Scientific 25-508 PBS (Phosphate buffered saline; 137 mM NaCl, 2.7 mM KCl, 10 mM10mM Na 2 HPO 4 , 1.8 mM8mM KH 2 PO 4 , 137mM NaCl, 2.7mM KCl, pH 7.4) N/A N/A TBS (Tris-buffered saline; 20 mM20mM Tris, 150 mM-Cl, 150mM NaCl, pH 7.5 ) N/A N/A PBS-T (PBS, 0.1 % Tween 20, pH 7.4) N/A N/A TBS-T (TBS, 0.1% Tween 20) N/A N/A Laemmli sample buffer Bio-Rad 161-0737 Critical commercial assays HMGB1 Detection Kit Chondrex, Inc 6010 DNeasy Powerlyzer Microbial kit Qiagen 12255-50 Pierce BCA protein assay Thermo Scientific PI23227 Molecular ProbesTM Alexa FluorTM 647 Microscale Protein Labeling Kit Invitrogen A30009 CellEvent Caspase-3/7 Red detection reagent Invitrogen C10430 Deposited data Bacterial 16S rRNA gene sequencing data DOI: 10.5281/zenodo.14968005 Experimental models: Cell lines C2BBe1 [clone of Caco-2] CRL-2102TM ATCC C2BBe1 WT and ΔHMGB1 Cyagen Custom Experimental models: Organisms/strains Hmgb1 fl/fl (WT) mice Eugene Chang Hmgb1 tm1.1Ebc Hmgb1 fl/fl,Vil-CRE (ΔIEC) Eugene Chang Hmgb1 tm1.1Ebc crossed to Tg(Vil1-cre)20Syr SPF C57BL/6J Jackson Labs 000664; RRID: IMSR_JAX:000664 Germ-free C57BL/6 University of Chicago and Cleveland Clinic Gnotobiotics Core Facilities RRID: IMSR_TAC:B6 Oligonucleotides 5ATTO647NN/GCT GCC TCC CGT AGG AGT IDT ATTO647NN EUB338 probe GGCATTCGGGCTCCTTTCTT Invitrogen Mouse Muc1 F TGGAGTGGTAGTCGATGCTAAG Invitrogen Mouse Muc1 R AGGGCTCGGAACTCCAGAAA Invitrogen Mouse Muc2 F (Continued on next page) e3 Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 ..

    Sequencing:

    Article Title: HMGB1 functions as a critical mediator of host defense at the gut mucosal barrier.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER E. coli FimH lectin domain; ToH1 mutant -His tagged Messer Laboratory FimH LD Mut Enterococcus faecalis Asa1 (Uniprot P17953) -His tagged Genscript Asa1 (Custom) Human HMGB1 peptide Abcam ab18650 Enterococcus faecalis Asa1 ToH1 peptide Genscript Asa1 ToH1 peptide (Custom) Bisbenzimide H 33258 (Hoechst) Sigma-Aldrich 14530 CAS: 23491-45-4 Bacto Peptone VWR 90000-264 Beef Extract VWR 90000-588 NaCl Fisher S671-500 Agar Fisher BP1423 500 Methanol Fisher A4124 Chloroform Fisher AC158210025 Glacial acetic acid Fisher BP2401 212 SYTO 9 Invitrogen S34854 Bovine Serum Albumin Sigma-Aldrich A2153-500G Paraformaldehyde Aqueous Solution Fisher 15710 Lysozyme Fisher PI89833 LB agar (Lennox) Sigma-Aldrich L2897-250G 3,3 ′ ,5,5 ′ -Tetramethylbenzidine (TMB) Sigma-Aldrich T8665-100ML Sulfuric acid Fisher AC424525001 Cell lysis buffer Cell Signaling Technology 9803S Complete protease inhibitor Roche 11836170001 Phenylmethylsulfonyl fluoride (PMSF) Gold Biotechnology P-470-10 14-2% NuPAGE Bis-Tris gels Fisher NP0321BOX 12% NuPAGE Bis-Tris gels Fisher NP0341BOX NuPAGE MOPS SDS Running Buffer Fisher NP0001 NuPAGE Transfer Buffer Fisher NP00061 Prolong glass mountant Thermo Fisher P36980 Clarity Western ECL Substrate Biorad 1705061 Formamide deionized MP Biomedical 11FORMD002 Kifunensine Cayman Chemical 10009437 D-(+)-mannose Sigma-Aldrich M6020 Advanced DMEM/F12 Life Technologies 12634 L-Glutamine Life Technologies 25030 Tween-20 Fisher BP337-500 DMEM Cleveland Clinic 11-500 Fetal Bovine Serum Gibco A5256701 HEPES buffer Life Technologies 15630 Penicillin and streptomycin Life Technologies 15140 N2 supplement Life Technologies 17502 B-27 Supplement Minus Vitamin A Life Technologies 12587 Murine Epidermal Growth Factor Peprotech 31509 Noggin Peprotech 250-38 Jagged 1 Anaspec AS-61298 Y-27632 Cayman Chemical Company 10005583 R-spondin Peprotech 120-38 TRIzol Life Technologies 15596026 SYBR Green Master Mix Bio-rad 172-51240 PowerUp SYBR Green Master Mix Applied Biosystems A25777 RemelTM BHI Broth Thermo Scientific R452472 (Continued on next page) Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Propidium iodide Alfa Aesar J66764MC CellBrite®Fix Membrane Stains (488, 555) Biotium 30090, 30088 NuPAGE LDS Invitrogen NP0007 NUPAGE 3-8% Tris-acetate gel Invitrogen EA0375Box Intercept (PBS) blocking buffer LICORbio 927-7 NuPAGE Tris-acetate SDS running buffer Invitrogen LA0041 Sodium Dodecyl Sulfate (SDS) Fisher Scientific BP166-100 β-mercaptoethanol MP Biomedicals 0219483425 SuperiorTM Blocking Buffer Thomas Scientific C752H38 EZ-link NHS-biotin Thermo Scientific 20217 High-Capacity cDNA Reverse Transcription Kit Thermo Scientific 4368814 Sulfo-SBED Thermo Scientific 33033 PurMa Agarose Low Melting Point PurMa Biologics PIM0121117-50 Guinea Pig Red Blood Cells Innovative Research IGPRBC10ML Anti-DYKDDDDK affinity resin Pierce A36802 Dulbecco’s PBS (DPBS) Genesse Scientific 25-508 PBS (Phosphate buffered saline; 137 mM NaCl, 2.7 mM KCl, 10 mM10mM Na 2 HPO 4 , 1.8 mM8mM KH 2 PO 4 , 137mM NaCl, 2.7mM KCl, pH 7.4) N/A N/A TBS (Tris-buffered saline; 20 mM20mM Tris, 150 mM-Cl, 150mM NaCl, pH 7.5 ) N/A N/A PBS-T (PBS, 0.1 % Tween 20, pH 7.4) N/A N/A TBS-T (TBS, 0.1% Tween 20) N/A N/A Laemmli sample buffer Bio-Rad 161-0737 Critical commercial assays HMGB1 Detection Kit Chondrex, Inc 6010 DNeasy Powerlyzer Microbial kit Qiagen 12255-50 Pierce BCA protein assay Thermo Scientific PI23227 Molecular ProbesTM Alexa FluorTM 647 Microscale Protein Labeling Kit Invitrogen A30009 CellEvent Caspase-3/7 Red detection reagent Invitrogen C10430 Deposited data Bacterial 16S rRNA gene sequencing data DOI: 10.5281/zenodo.14968005 Experimental models: Cell lines C2BBe1 [clone of Caco-2] CRL-2102TM ATCC C2BBe1 WT and ΔHMGB1 Cyagen Custom Experimental models: Organisms/strains Hmgb1 fl/fl (WT) mice Eugene Chang Hmgb1 tm1.1Ebc Hmgb1 fl/fl,Vil-CRE (ΔIEC) Eugene Chang Hmgb1 tm1.1Ebc crossed to Tg(Vil1-cre)20Syr SPF C57BL/6J Jackson Labs 000664; RRID: IMSR_JAX:000664 Germ-free C57BL/6 University of Chicago and Cleveland Clinic Gnotobiotics Core Facilities RRID: IMSR_TAC:B6 Oligonucleotides 5ATTO647NN/GCT GCC TCC CGT AGG AGT IDT ATTO647NN EUB338 probe GGCATTCGGGCTCCTTTCTT Invitrogen Mouse Muc1 F TGGAGTGGTAGTCGATGCTAAG Invitrogen Mouse Muc1 R AGGGCTCGGAACTCCAGAAA Invitrogen Mouse Muc2 F (Continued on next page) e3 Cell Host & Microbe 34, 1–15.e1–e13, February 11, 2026 ..



    Similar Products

    25 508 pbs  (Thermo Fisher)
    99
    Thermo Fisher 25 508 pbs
    25 508 Pbs, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/25+508+pbs/Tween+20/pm41638212-817-101-186
    Average 99 stars, based on 1 article reviews
    25 508 pbs - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    25 508 pbs  (Bio-Rad)
    98
    Bio-Rad 25 508 pbs
    25 508 Pbs, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/25+508+pbs/Tris/pm41638212-817-101-169
    Average 98 stars, based on 1 article reviews
    25 508 pbs - by Bioz Stars, 2026-11
    98/100 stars
    		  Buy from Supplier
    saline pbs  (Genesee Scientific)
    94
    Genesee Scientific saline pbs
    Saline Pbs, supplied by Genesee Scientific, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/25+508+pbs/DPBS%2C+without+Ca%2C+Mg%2C+Phen/pmc11717534-123-1-3
    Average 94 stars, based on 1 article reviews
    saline pbs - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    phosphate buffered saline pbs  (Genesee Scientific)
    94
    Genesee Scientific phosphate buffered saline pbs
    Phosphate Buffered Saline Pbs, supplied by Genesee Scientific, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/25+508+pbs/DPBS%2C+without+Ca%2C+Mg%2C+Phen/10__21769_slash_bioprotoc__5144-62-0-3
    Average 94 stars, based on 1 article reviews
    phosphate buffered saline pbs - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    1x pbs  (Genesee Scientific)
    94
    Genesee Scientific 1x pbs
    1x Pbs, supplied by Genesee Scientific, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/25+508+pbs/DPBS%2C+without+Ca%2C+Mg%2C+Phen/bio_rxiv__2024__08__29__610041-167-25-27
    Average 94 stars, based on 1 article reviews
    1x pbs - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    pbs  (Genesee Scientific)
    94
    Genesee Scientific pbs
    Pbs, supplied by Genesee Scientific, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/25+508+pbs/DPBS%2C+without+Ca%2C+Mg%2C+Phen/pm38193729-424-13-16
    Average 94 stars, based on 1 article reviews
    pbs - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    sterile pbs  (Genesee Scientific)
    94
    Genesee Scientific sterile pbs
    Sterile Pbs, supplied by Genesee Scientific, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/25+508+pbs/DPBS%2C+without+Ca%2C+Mg%2C+Phen/pmc10529244-320-11-13
    Average 94 stars, based on 1 article reviews
    sterile pbs - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier

    Image Search Results